این سایت در حال حاضر پشتیبانی نمی شود و امکان دارد داده های نشریات بروز نباشند
صفحه اصلی
درباره پایگاه
فهرست سامانه ها
الزامات سامانه ها
فهرست سازمانی
تماس با ما
JCR 2016
جستجوی مقالات
یکشنبه 23 آذر 1404
پژوهش های علوم دامی
، جلد ۲۹، شماره ۳، صفحات ۶۱-۷۰
عنوان فارسی
ارتباط چندشکلی ژن NPY با صفات تولید مثلی در بوقلمون های ایران
چکیده فارسی مقاله
زمینهی مطالعاتی: نوروپپتیدY یک نوروترنسمیتر در هیپوتالاموس است که نخستین بار از هیپوتالاموس مغز خوک استخراج شد و محرک اشتها و موثر بر هورمون های تولیدمثلی است. هدف: هدف این مطالعه، توالی یابی و بررسی ارتباط ژن NPY با صفات تولیدمثلی در بوقلمونهای بومی ایران است. این صفات شامل وزن تودهی تخم تولیدی، طول دورهی تخمگذاری، سن بلوغ جنسی و وزن اولین تخم میباشد. روش کار: 120 بوقلمون ماده به طور تصادفی از ایستگاه تحقیقات بوقلمون استان آذربایجان شرقی انتخاب شد و رکوردهای تولید مثلی آنها ثبت شد. از نمونه ی خون بوقلمون ها برای استخراج DNAاستفاده شد. قطعه ی 725 جفت بازی ژن NPY با استفاده از پرایمرهای طراحی شدهی اختصاصی تکثیر شد. چندشکلی ژن NPY با توالی یابی محصولات PCR بررسی شد. نتایج: 4 جایگاه چندشکلی C552T ، T544A، T360G و C367A در توالی ژن NPYیافت شد. نتایج ارتباط معنی داری بین جایگاه T360G با صفت وزن کل تخم نشان داد و چندشکلی A544T ارتباط معنی داری با وزن تخم و طول دورهی تخمگذاری داشت. نتیجه گیری نهایی: در نتیجه چندشکلیهای جدیدی در ناحیه اینترونی ژن NPY مشخص شد که بر صفات وزن کل تخم، تعداد تخم و طول دوره تخمگذاری تاثیر داشت. نتایج این پژوهش میتواند در برنامههای اصلاح نژادی بوقلمونهای بومی شمال غرب ایران مورد توجه قرار گیرد.
کلیدواژههای فارسی مقاله
چندشکلی، بوقلمون، نوروپپتید y، طول دوره ی تخمگذاری، وزن تخم،
عنوان انگلیسی
NPY gene polymorphisms associate with reproductive traits of turkeys in Iran
چکیده انگلیسی مقاله
Introduction: Neuropeptide Y (NPY) is a neurotransmitter that presents at high concentrations in the hypothalamus. Neuropeptide Y is one of the most abundant peptides in chicken's brain, which works as a neurotransmitter in many functions and behaviors. The first time, it was extracted from the pituitary hypothalamus of pigs. This neuropeptide stimulates appetite and affects reproductive hormones. It was showed that there is a significant association between NPY gene and growth and reproductive traits of animals. The aim of this study was to investigate NPY gene polymorphisms and their association with reproductive traits in indigenous turkeys of Iran. These traits were including total egg weight production, length of laying period, age at the first egg, and the weight of the first egg. Materials and methods: A hundred and twenty turkey hens were randomly chosen from turkey's breeding center of East Azerbaijan of Iran. They were recorded for the reproductive traits. The blood samples of the birds were taken from their wing veins and used for DNA extraction. DNA was isolated from each animal's blood samples using salting-out method (Miller et al 1999).A fragment of 725bp of NPY gene was amplified using designed specific primers. The forward and reversed primers were GAAGCGTACCCCTCCAAAC and CCCCTTTAAGCAGCACAGTC, respectively. PCR was performed in a final volume of 25 ml containing 2ml of DNA template, 1.2 ml of each primer, 8.1 ml water and 12.5 ml master mix containing: dNTP, proofreading Taq polymerase, MgCl2, and 1x PCR buffer. Thereafter, the PCR was programmed as follows: an initial denaturation step at 94°C for 5 min, followed by 32 cycles of 94°C for 60 s, 56° C for 40 s, and 72°C for 45 s. A final extension step was performed at 72°C for 8 min. Electrophoresis of the amplicons was carried out on 1.5% agarose gels, and the gels were visualized under ultraviolet light after 45 minutes in 85 Volt. It should be noted that PCR products were purified and sequenced by Bioneer Company. The polymorphisms of the NPY gene was identified by commercially sequencing the PCR products and aligning the sequences using BioEdit software. PopGen32 software was used to identify genotype and allele frequencies. The associations of polymorphisms or haplotypes with the traits were analyzed using the SAS GLM procedure. Multiple comparisons of Tukey's test were performed to find differences among means. Results and discussion: The results revealed four novel SNPs in the NPY gene, which has not been already reported in turkey. The detected polymorphisms were including T360G, C367A, T544A, and C552T. Results of statistical analysis showed that there was a significant association between T360G and total egg weight. The T allele was the favorable allele for total egg weight trait as the TT genotype significantly increased the weight of produced eggs. The polymorphism of A544T was significantly associated with egg weight and laying length. The AA genotype of A544T positively influenced both egg weight and laying length traits. Both SNPs were located in the intron region of the gene. Although intronic mutations are not capable of altering the synthesized protein structure and/or changing the function of the protein, they may affect the level of gene transcription. Additionally, it was proved that the intronic polymorphisms may affect the gene expression levels via influencing the splicing process. Several studies have already been revealed that the NPY gene polymorphism, especially on the promoter and 5'-UTR regions, affect the reproductive traits of chicken. There is another study that reported a significant association between the SNPs of intron 3 of the NPY gene with growth and body traits in cows. It has been proven that NPY neuron terminals directly end on GnRH neurons and NPY is synthesized prior to the release of GnRH. It then releases the follicular stimulating hormone (FSH) and the luteinizing hormone (LH) from the pituitary gland. It has been shown that NPY influences GnRH secretion via affecting Kisspeptin neurons, which consequently alter reproductive traits. Also, stimulating the secretion of the GnRH through the neuropeptide receptors can lead to early maturity in the chicken. On the other hand, it was revealed that stimulation of NPY neurons mediates an increase in energy intake and storage. Altering the NPY gene expression in the hypothalamus of birds resulted in changing energy status. Moreover, NPY has been shown to be a potent appetite stimulating agent in chickens. Specific NPY receptors (Y1 and Y5) have been reported to mediate NPY effects on feeding behavior in chickens. In order to continue laying eggs, turkey hens need a higher amount of available energy and nutrients. Investigations in humans also represented that polymorphisms in NPY influenced fatness in men and was linked to body weight, BMI, body fat prototype, and leptin levels (Ding 2005, Van 2006). Concentrations of NPY are prominent when body fat reservoirs are fully consumed, resulting in hunger enlargement (Kalra et al. 1991). Consequently, upon negative energy balance, NPY levels are anticipated to be elevated. In addition, NPY has been recognized as a major controller of leptin action in the hypothalamus, affecting the discharge of LH and somatotropin (Kalra et al. 1991). This study has pointed out considerable relationships among leptin and NPY SNP with vital intensification, fertility, and milk production characteristics (Clempson et al. 2010). Also, it is assumed to be the cause of augmenting body mass index (BMI) in two different Swedish statistical groups of normal and fat peoples (Ding et al. 2005). The -880I/D advocate region variant of NPY might impact body fat prototyping in non-obese Mexican Americans from Starr County (Bray et al 2000). Therefore, effect of NPY on appetite may influence the supply of nutrients and energy to be consumed for reproductive performance specially egg production traits. Conclusion: In conclusion, four novel polymorphisms were detected in intron 1 of Meleagrine NPY gene. The polymorphisms of the NPY gene may affect some of egg production traits. If these effects validate by investigating them in a larger or another turkey population, they can be considered in breeding programs of native turkey population in North-West of Iran.
کلیدواژههای انگلیسی مقاله
نویسندگان مقاله
نیلوفر راستیدوست |
گروه علوم دامی دانشگاه محقق اردبیلی
سعید نیکبین |
گروه علوم دامی دانشگاه محقق اردبیلی
بهمن نوید شاد |
گروه علوم دامی دانشگاه محقق اردبیلی
قربان الیاسی |
گروه علوم دامی مرکز تحقیقات جهاد کشاورزی تبریز
نشانی اینترنتی
https://animalscience.tabrizu.ac.ir/article_9968_32ae44845c150c3515db3e775b7714f3.pdf
فایل مقاله
اشکال در دسترسی به فایل - ./files/site1/rds_journals/1407/article-1407-2298297.pdf
کد مقاله (doi)
زبان مقاله منتشر شده
fa
موضوعات مقاله منتشر شده
نوع مقاله منتشر شده
برگشت به:
صفحه اول پایگاه
|
نسخه مرتبط
|
نشریه مرتبط
|
فهرست نشریات