| کلیدواژههای انگلیسی مقاله |
Apigenin, Synovial membrane, Mesenchymal stem cells, Osteoarthritis, Inflammation, What&,rsquo s Known Mesenchymal stem cells have been widely used as a therapeutic approach in the cell-based therapy of osteoarthritis, with promising effects on cartilage regeneration. Apigenin acts as a free radical scavenger and anti-inflammatory agent. What&,rsquo s New The co-injection of apigenin and mesenchymal stem cells to the knee will increase the success of osteoarthritis therapy. Apigenin effects are possibly mediated through the reduction of oxidative stress, suppression of inflammation, and promotion of production of extracellular matrix components. IntroductionOsteoarthritis (OA) is the leading cause of functional limitations and disability worldwide that adversely impacts patients&,rsquo quality of life. The disease is associated with degeneration of the cartilage, which causes chronic joint inflammation, leading to arthritis. 1, It has been shown that oxidative stress signaling pathways may play an important role in the pathogenesis of OA. 2, Inflammatory inducers initiate the production of inflammatory mediators such as tumor necrosis factor-alpha (TNF-&,alpha ), interleukin (IL)-1&,beta , IL-8, adipokines, Toll-like receptor (TLR), and nitric oxide (NO). 3, IL-1&,beta decreases the expression of type II collagen and increases the expression of nitric oxide-synthase (NOS), cyclooxygenase (COX)-2, and matrix metalloproteinases (MMPs). 4, These events accelerate destructive responses affecting extracellular matrix (ECM) components, catabolic activation, and apoptosis. 5, There is no effective cure for OA, and available therapies mostly focus on managing symptoms. Regeneration of the damaged articular cartilage in OA has been a challenging topic. 2, Recently, mesenchymal stem/stromal cells (MSCs) have been introduced as the preferred alternative, since they do not have the drawbacks of other methods. The concept of using MSCs is based on the fact that synovial membrane-derived MSCs (SMMSCs) can differentiate into chondrocytes and regenerate the damaged regions due to various trophic factors. Several in vivo assessments (animal and human studies) confirmed the high potency of MSCs in cartilage repair. 3, , 6, , 7, It has been shown that combination therapy could be a potential therapeutic approach to address OA symptoms. 8, Considering the role of a wide range of molecular mechanisms in the pathogenesis of OA, the use of combined agents that target these pathways is suggested. 9, For example, it has been shown that elevated oxidative stress markers are associated with the pathogenesis of OA. Hence, the use of antitoxin factors is effective in OA therapy. 9, Flavonoids, a polyphenolic class of phytochemicals, were shown to control inflammatory arthritis due to their antioxidant, anti-inflammatory, and immunomodulatory properties. 10, Apigenin (4&,prime ,5,7-trihydroxyflavone) is a flavonoid found in fruits and vegetables with a wide spectrum of pharmacological activities including antioxidant, anti-inflammatory, and anti-cancer properties. 11, The anti-inflammatory activity of apigenin is also linked to its inhibitory effect on the production of cytokines such as IL-4, IL-5, or IL-13, and inhibition of NOS and COX2 enzymes in T and B cells. 12, Considering the need to identify additional effective therapeutic options for OA treatment, we investigated the effect of the co-injection of apigenin and SMMSCs on OA in male rats&,rsquo knee joints.Materials and MethodsMale Sprague-Dawley rats (n=48), weighing 200&,plusmn 20 g and aged 10-12 weeks were obtained from the Central Animal House of Shiraz University of Medical Sciences (Shiraz, Iran). The rats were housed in a standard vivarium, fed a standard diet, and water ad libitum, and kept under standard conditions (12-hour light,dark cycle, temperature 20-25 &,ordm C, and humidity 25-35%). Experimental protocols were according to the Guide for the Care and Use of Laboratory Animals. The study was approved by the Ethics Committee of Shiraz University of Medical Sciences, Shiraz, Iran (code, IR.SUMS.REC.1397.228).The rats were randomly divided into eight groups (n=6 per group), and anterior cruciate ligament transection (ACLT) 13, was used to induce OA, except for the sham group. For three weeks, the rats were treated once-weekly with intra-articular injections of apigenin alone or in combination with either SMMSCs (three million cells), phosphate-buffered saline (PBS), or hyaluronic acid (H).Sham, No intervention+treatment with PBSOA (Negative control), OA+treatment with PBSPositive control, OA+treatment with HOA+treatment with MSCs OA+treatment with apigenin 0.1 &,micro M OA+treatment with MSCs and apigenin 0.1 &,micro M OA+treatment with apigenin 0.3 &,micro M OA+treatment with MSCs and apigenin 0.3 &,micro M Induction of ACLTThe rats were intraperitoneally anesthetized using 40 mg/kg ketamine (KetaVed&,reg , Vedco, St. Joseph, MO, USA) and 10 mg/kg xylazine (Rompun Bayer AG, Leverkusen, Germany). After shaving and disinfecting the rats, the left medial parapatellar was incised to expose the knee joint. The joint cavity was revealed and the anterior cruciate was exposed through knee flexion. An anterior cruciate ligament (ACL) was detached and the rupture was confirmed using the drawer test. The cartilage surface was not damaged during the operation. In the sham group, ACL was exposed through a small medial parapatellar incision, the joint was washed with saline, and then the incision was sutured. Flunixin (2.5&,#8197 mg/kg/day Banamine&,reg , Merck Animal Health USA) was subcutaneously injected daily for three days for postsurgical analgesia. The rats were given supplemental heat and closely monitored until full recovery from anesthesia. They were also monitored daily for pain, infection, and other postoperative complications. All procedures were approved by the Animal Welfare Committee.Preparation of SMMSCsPreparation of SMMSCs was performed according to the previously reported procedure. 14, Cell-Surface Marker AnalysisSMMSCs were confirmed by evaluating the expression of MSCs specific surface markers (including CD34, CD45, CD29, CD73) using RT-PCR analysis. 15, Cultured cells were harvested, and total RNA was isolated using an RNA extraction kit (Qiagen, USA) according to the manufacturer&,rsquo s protocol. At the end of the isolation process, the concentration of samples was determined with a spectrophotometer (Nanodrop Thermo Fisher Scientific, Wilmington, DE, USA). RevertAid&,trade First Strand cDNA Synthesis kit (Thermo Fisher Scientific Inc., Waltham, MA, USA) was used for cDNA synthesis. Reverse transcriptionquantitative polymerase chain reaction (RTqPCR) was performed using ABI Biosystems&,trade StepOne&,trade and RealQ Plus 2x Master Mix Green (Ampliqon A/S, Odense, Denmark). The &,beta 2M housekeeping gene was used as the internal control of qPCR reactions. Reactions were amplified in a thermal cycler (Applied Biosystems, Thermo Fisher Scientific Inc., USA) with thermal conditions set at 94 &,deg C for 10 min followed by 40 cycles of 15 second at 94 &,deg C, 60 second at 58 &,deg C, a final extension of 7 min at 72 &,deg C, and melt curve analysis of 55~95 &,deg C at 0.5 &,deg C per five second. The analysis of real-time PCR data was performed using the 2-&,Delta &,Delta Ct method 16, with target mRNA expression in each sample normalized against the endogenous control.Differentiation AssayTo induce differentiation, SMMSCs were seeded into 6-well plates at a density of 5&,times 104 per well, and the medium was replaced after 24 hours with either adipogenic, osteogenic (R&,amp D Systems), or fresh media. After three weeks, SMMSCs were washed twice in PBS, fixed for 30 min in 10% formaldehyde, and then washed with water twice. Then, SMMSCs were stained with fresh Oil Red O solution (0.5%) or Alizarin Red S solution (1.4%) for 40 min at room temperature. Intra-Articular InjectionTwo months after surgery, animals were checked for the induction of the ACLT model using radiological imaging. For three weeks, the rats were treated once-weekly with intra-articular injections of apigenin (Sigma Aldrich, 10798-100MG) alone or in combination with either SMMSCs or PBS vehicle under general anesthesia. Injections were carried out in both knees in a volume of 50 &,mu l using Hamilton syringes.Assessment of Cell Viability with MTT AssayMTT assay was used to evaluate the potential toxicity of apigenin on the cells. SMMSCs were plated into 96-well plates at a density of 5&,times 103 per well. After 24 hours, the media were replaced with fresh media enriched with different concentrations of apigenin (0, 0.1, 0.2, 0.3, 0.4, and 0.5 &,micro M). After 24, 48, and 72 hours, cell viability was measured by MTT assay. After incubation with MTT solution (5 mg/ml) at 37 &,deg C and 5% CO2 for four hours, the supernatant was discarded and dimethylsulphoxide (DMSO) was added to each well. Cell viability was calculated as the ratio of optical density (OD) of each concentration point, measured at 570 nm, relative to that of the negative control.RadiographyKnee joints were examined under general anesthesia using a Dry Imager (Fujifilm DryPix 6000 smart Tokyo, Japan) to evaluate the severity of OA before and after treatment. Radiographic grading was based on previously published numerical rating scales. 17, Knee Joint SpecimenAfter imaging, animals were sacrificed by cervical dislocation. Knee joints were exposed and dissected aseptically from superior and inferior tissues. Some specimens were fixed in 10% paraformaldehyde for histopathological study, and some others were immediately frozen in liquid nitrogen and stored at -80 &,deg C for enzyme-linked immunosorbent assay (ELISA) and PCR analysis.ELISAIL-1&,beta , TNF-&,alpha , and superoxide dismutase (SOD) levels in the cartilage homogenate (SpeedMill PLUS Analytik Jena, Germany) were measured using commercially available ELISA kits (Abcam, USA), according to the manufacturer&,rsquo s instructions. OD was measured at 450 nm using a microplate reader (POLARstar, BMGLabtech, Ortenberg, Germany). Data were normalized by detecting the protein concentration of samples using bicinchoninic acid (BCA) protein assay kit (Beyotime, Shanghai, China).Malondialdehyde (MDA) MeasurementMDA is a product of lipids peroxidation and is known as a marker of oxidative stress intensity. MDA can be quantified based on its reaction with thiobarbituric acid, a chromogenic reagent. 18, Briefly, the fresh tissue homogenate was placed into a 1.5 ml centrifuge tube with 1.15% potassium chloride solution. Thiobarbituric acid reactive substance (TBARS) assay reagent (2000 &,mu l) was then added to the tissue homogenate (500 &,mu l) and the solution was heated in a boiling water bath for 45 min. After cooling, 2 ml n-Butanol was added to each tube. The homogenate was then centrifuged and the supernatant was examined using a Thermo Spectronic Genesys five microplate reader (Labequip, Ontario, Canada) for colorimetric assay (OD 532 nm).RT-qPCR AssessmentReal-time PCR was conducted to quantify changes in the mRNA levels of different genes, including collagen 2a1, aggrecan, IL1&,beta , TNF-&,alpha , iNOS, SOX-9, MMP-3, and MMP-13. The &,beta 2M gene was used as a housekeeping gene. Briefly, cartilage tissue was collected from the femoral and tibial condyles of each knee joint and ground using a mortar and pestle. Total RNA was isolated and analyzed as described above. The sequence of specific primers is presented in table 1,. Gene nameAccession numberPrimer sequence (5&,rsquo 3&,rsquo )Size (bp)CD34 NM_001107202.2Forward, AGCCATGTGCTCACACATCA257Reverse, CAAACACTCGGGCCTAACCT |