| کلیدواژههای انگلیسی مقاله |
Efflux pump, Gene expression, Pseudomonas aeruginosa, Norfloxacin, Gentamicin, What&,rsquo s Known Satureja khuzistanica essential oil (SKEO) has antibacterial activity against Pseudomonas aeruginosa. What&,rsquo s New For the first time, the effect of Satureja khuzistanica essential oil on the expression of efflux pump genes of Pseudomonas aeruginosa is demonstrated. Satureja khuzistanica essential oil reduced the expression of efflux pumps and the MIC values of norfloxacin and gentamicin in vitro. IntroductionPseudomonas aeruginosa (P. aeruginosa) is an important cause of nosocomial infections, which can rapidly develop resistance to many antibiotics through various mechanisms such as the high expression of efflux pumps. 1, Resistance-nodulation-division family transporters are the main category of efflux pumps in P. aeruginosa and contain at least 10 different types of efflux pumps. 2, MexXY-OprM and mexEF-OprN are the two most relevant pumps systems involved in resistance to antimicrobial agents. 3, MexXY-OprM has a main role in extruding various antibiotics in P. aeruginosa isolates, particularly beta-lactam antibiotics. 4,, 5, Its expression commonly occurs in wild type strains and involves innate bacterial resistance to a number of antibiotics. 2,, 6, However, mexEF-OprN pump is expressed at low levels in wild-type isolates 7,, 8, and contributes to acquired resistance to antibiotics. 9, A previous study described some compounds such as herbal extracts could inhibit the activity of efflux pumps. 10, When plant extracts are used concurrently with chemical drugs, they enhance the effectiveness of antibiotics and can also act as an efflux pump inhibitor (EPI). 11, EPIs interrupt the extruding process of antibiotics by interference with the regulatory steps thereby suppressing the efflux pumps gene expression. 12, Checkerboard and real-time polymerase chain reaction (PCR) techniques can be used to assess the indirect activity of essential oils on the gene expression of efflux pumps. Compared with the checkerboard method, real-time PCR is a rapid technique with a high specificity and sensitivity, low contamination rate, and excellent efficiency in determining the synergistic effect. 13, Satureja khuzistanica (S. khuzistanica) is an endemic plant in southern Iran. It has an antimicrobial activity due to the presence of essential oil content. 14, The principal components of S. khuzistanica are thymol and carvacrol, which can damage bacteria. These substances, after disruption of efflux pumps, indirectly inhibit the gene expression of efflux pumps. The present study aimed to assess the reduced expression of efflux pump genes of P. aeruginosa with S. khuzistanica essential oil (SKEO). Materials and MethodsThe present cross-sectional study was conducted in 2016 at the Microbiology Laboratory of Baqiyatallah University of Medical Sciences, Tehran, Iran. The minimum inhibitory concentration (MIC) and checkerboard synergy assays were carried out in the cation-adjusted Mueller-Hinton broth (Hi-Media, India). Strains and Inoculum PreparationP. aeruginosa strains were isolated from the pus and wound specimens of burn patients referred to Shahid Motahari Hospital, Tehran, Iran. Multidrug-resistant (MDR) isolates were detected using the disk diffusion method according to the Clinical and Laboratory Standards Institute (CLSI, supplement M100) instructions. P. aeruginosa PAO1 was used as a standard strain. 15, Preparation of SKEOBased on the method recommended by the European Pharmacopeia, dry aerial parts (100 g) of S. khuzistanica were subjected to hydrodistillation for three hours using a Clevenger-type apparatus (Bakhtaran Co., Iran). The content of the device was kept at room temperature for 24 hours and subsequently mixed at the speed of 130 rpm using a shaker. A rotary device was used to remove solvents from the samples. Then, the sample was filtered using a vacuum pump. The obtained extract was weighed and then dissolved in dimethy sulfoxide (DMSO) solvent (Merck, Germany). The solution was kept in a refrigerator (Donar, Iran) at 4 &,deg C for further use.Determination of MIC The macro broth dilution method was used to determine the MIC value of SKEO against MDR isolates. To dissolve SKEO, 100 &,mu g/mL DMSO solvent was added to SKEO concentrations of 100, 120, 140, 160, 180, 200, 220, and 240 &,mu g in eight sterile glass tubes (13&,times 100 mm). Each tube was filled with 1 mL of Muller-Hinton broth and isolates were inoculated into tubes. After mixing, 1 mL of bacterial suspension (106 CFU/mL) was added to each tube and the final concentration of 5&,times 105 CFU/mL was obtained. After incubation at 37 &,ordm C for 24 hours, the minimal concentration of SKEO inhibiting bacterial growth was defined as MIC. 16, RNA Extraction and cDNA SynthesisA total of five MDR isolates were cultured in Muller-Hinton broth and suspended in diluted SKEO with a concentration below the MIC value and incubated at 37 &,ordm C for 24 hours. The total RNA was extracted using an RNA extraction kit (Qiagen, USA) according to the manufacturer&,rsquo s instruction. Then, cDNA was synthesized in a total volume of 20 &,mu L reaction mixture, including 2 &,micro g of the extracted RNA, 1 &,mu L of deoxyribonucleotide triphosphate (10 mM), 50 ng of random Hexamer primer, 2 &,mu L of M-MuLV buffer (10X) (Macrogen&,reg , Korea), and 100 U of M-MuLV reverse transcriptase under an initial denaturation at 65 &,ordm C for five minutes and reverse transcription steps at 42 &,ordm C for one hour (Vivantis Technologies, Malaysia). The products were then used in the reverse transcription-polymerase chain reaction (RT-PCR) and PCR assay. The primers used in the PCR, RT-PCR, and quantitative reverse transcription PCR (qRT-PCR) assays are presented in table 1,.PrimersSequence (5&,prime &,rarr 3&,prime )Amplicon size (bp)ReferencemexY-FGCCCAACGACATCTACTTCA108Present studymexY-RATGCCTTCCTGGTAATGGTCmexE-FTCCTCAAGTACGTCGAGCTG131Present studymexE-RGACCTGGTTGTCGAGGAAGTgyrA-FGGTCTGGGCATAGAGGTTGT121Jalalvandi17,gyrA-RGAAGATCGAGGGTATTTCCGTable 1. Oligonucleotides sequences used in the present studyThe RT-PCR reaction was performed using the RevertAid first-strand cDNA synthesis kit (Fermentas, USA) in a total volume of 25 &,mu L reaction mixture, including 1 &,micro g of cDNA (10 mM) and 0.3 pmol of each primer (table 1,). The PCR condition included an initial denaturation at 95 &,deg C for two minutes 35 cycles at 95 &,deg C for 30 seconds, 57 &,deg C for 30 seconds, and 72 &,deg C for 30 seconds and a final extension at 72 &,deg C for five minutes. GyrA was used as an internal control. PCR products were subjected to 1% agarose gel electrophoresis and visualized under Ultraviolet (UV) light using the gel documentation system (Bio-Rad, Germany). Real-Time PCR The changes in the expression level of mexE and mexY genes before and after being subjected to SKEO were identified through cDNA amplification using the qPCR method. Real-time PCR was performed using the Corbett Palm-Cycler gradient thermal cycler (Qiagen, Germany) under the following conditions, 12.5 &,mu L of Maxima SYBR Green/ROX qPCR Master Mix 2X (Fermentas, USA), 2 &,mu L of template, and 0.3 pmol of each primer (table 1,). Amplification of all genes was carried out with one cycle pre-denaturation at 95 &,deg C for 10 minutes, 40 cycles of denaturation at 95 &,deg C for 20 seconds, annealing at 58 &,deg C for 20 seconds, and elongation at 72 &,deg C for 20 seconds, followed by a final step at 72 &,deg C for 60 seconds. Melting curve analysis was drawn at the terminal of the 40th cycle between 58-95 &,deg C. Moreover, the Livak method was used to determine relative changes in the expression of mexE and mexY genes in comparison with the housekeeping genes.Determination of MIC and Checkerboard Synergy Assay The MIC values of gentamicin (MAST, England) and norfloxacin (MAST, England) in the absence and presence of SKEO were characterized using macro broth dilution and checkerboard assays. To assess the synergistic effects of SKEO, two-fold serial dilutions of gentamicin and norfloxacin were prepared and added into a 96-well microtitre plate. Dilutions for each antimicrobial agent ranged from 1.16 dilution to 2 sub-inhibitory concentrations. The second agent (SKEO) was also serially diluted at different sub-inhibitory concentrations, and 50 &,mu L of each dilution was added into each well. Then, 100 &,mu L of the bacterial suspension (106 CFU/mL) was added into the wells with a final volume of 200 &,mu L. Each experiment was controlled using solvent and growth sterility tests. All tests were carried out in duplicate. The microtiter plates were incubated at 37 &,deg C for 18 hours under aerobic conditions. Then, 10 &,mu L from each well was poured on the Muller-Hinton agar, and the checkerboard synergy result was obtained by calculating the fractional inhibitory concentration index (FICI) with the following formula, 18, MIC of antibiotic in combination MIC of antibiotic alone + MIC of SKEO in combination MIC of SKEO alone Based on the FICI value, synergism was defined as FICI&,le 0.5, indifferent as 0.5&,lt FICI&,le 4, and antagonism as FICI&,gt 4.Statistical AnalysisThe data were analyzed using SPSS software version 16.0. One-way analysis of variance (ANOVA) was used to compare the means of three or more groups. The post hoc Tukey HSD test was used for pairwise comparisons of the groups. P&,lt 0.05 was considered as statistically significant.ResultsAntibacterial Effect of SKEO, Gentamicin, and NorfloxacinThe MIC values of gentamicin, norfloxacin, and SKEO against PAO1 and five MDR strains were investigated. As shown in table 2,, SKEO showed dose-dependent antibacterial activity against P. aeruginosa strains. The MIC values of SKEO were in the range of 6 to 12 &,micro g/mL and the PAO1 was the most sensitive strain. Strains MIC (&,micro g/mL)FICI of SKEO with antibioticsSKEOGentamicinNorfloxacinGentamicinNorfloxacinPAO162 (S)0.5 (S)2 (I)1.83 (I)PA9104096 (R)32 (R)1.1 (I)0.32 (Sy)PA1184096 (R)16 (R)1 (I)0.37 (Sy)PA139&,gt 4096 (R)16 (R)ND0.45 (Sy)PA4172048 (R)16 (R)0.928 (I)0.41 (Sy)PA4212&,gt 4096 (R)64 (R)ND0.83 (I) I, Indifferent, Sy, Synergism, S, Sensitive, R, Resistance, ND, Not determined, SKEO, Satureja khuzistanica essential oil, MIC, Minimum Inhibitory Concentration, FICI, Fractional Inhibitory Concentration Index |