این سایت در حال حاضر پشتیبانی نمی شود و امکان دارد داده های نشریات بروز نباشند
Iranian Journal of Medical Sciences، جلد ۴۵، شماره ۵، صفحات ۳۵۹-۳۶۷

عنوان فارسی
چکیده فارسی مقاله
کلیدواژه‌های فارسی مقاله

عنوان انگلیسی Hydro-alcoholic Extract of Achillea Wilhelmsii C. Koch Reduces the Expression of Cell Death-Associated Genes while Inducing DNA Damage in HeLa Cervical Cancer Cells
چکیده انگلیسی مقاله Background: Achillea wilhelmsii C. Koch hydroalcoholic extract (AWHE) is proven to induce cell death. Previous studies suggested that AWHE is an effective inhibitor against the proliferation of prostate cancer cells. The present study aimed to evaluate possible alterations of cell death-associated genes and determine the growth inhibitory activity of AWHE on HeLa cervical cancer cells. Methods: The antiproliferative activity of AWHE was tested using the tetrazolium dye-based colorimetric assay (MTT assay). The mRNA levels of Vascular endothelial growth factor (VEGF), caspase-3, and Breast Cancer Susceptibility gene 1 (BRCA1) were measured using the real-time Polymerase Chain Reaction method. The in-cell levels of phosphorylated H2AX were determined using the in-cell ELISA method. The data were analyzed using the non-parametric ANOVA and Friedman tests. p Results: Based on the MTT assay, The half-maximal inhibitory concentration and 81.99 µg/mL, respectively. The mRNA levels of BRCA1 increased after 12 and 24 hours of treatment (p < 0.001), while the mRNA levels of VEGF significantly decreased after 12 hours (P=0.003) and 24 hours (P=0.001). Caspase-3 expression was increased in the HeLa cells after 6 and 12 hours (p < 0.001) whereas γ-H2AX levels significantly increased after 24 and 48 hours of treatment (p < 0.001). Conclusion: AWHE possesses growth inhibitory activity by altering the expression of cell death-associated genes. Using extracts from herbal plants may provide alternative strategies to be deployed in the fight against cancer.
کلیدواژه‌های انگلیسی مقاله Achillea, Uterine cervical neoplasms, Cell death, DNA repair, What&,rsquo s Known Cervical cancer is a major health concern and one of the most significant types of cancer in women worldwide. Achillea wilhelmsii C. Koch is a plant with components capable of triggering multiple signaling pathways, including cell death. What&,rsquo s New Achillea wilhelmsii C. Koch possessed pro-apoptotic effects and growth inhibitory activity of malignant cervical cells. Achillea wilhelmsii C. Koch reduced the expression of cell death-associated genes while enhancing phosphorylation of H2AX, as a highly sensitive marker of unrepaired DNA damage. IntroductionUterine cervical neoplasms, commonly known as cervical cancer (CC), is a major health concern and the fourth leading cause of cancer death among women worldwide. 1, The World health organization has reported that CC represented 6.6% of all female malignancies in 2018 with an estimated 570,000 new cases per year. 2, Many types of human papillomavirus (HPV) are believed to be the leading cause of CC. 3, The diagnosis of CC is primarily by Papanicolaou (Pap) smear and microscopic observation of visible lesions. 4, The treatment of pre-cancerous lesions includes cold knife conization, loop electrosurgical excision procedure (LEEP), freezing, cauterization, and laser surgery. However, to date, the main treatment strategies for the invasive stage of CC are chemotherapy and radiotherapy. 5, Recently, molecular biomarkers such as serum squamous cell carcinoma antigen (SCC-Ag), serum fragments of cytokeratin (CYFRA), carcinoma embryonic antigen (CEA), serum soluble CD44 (sCD44), and HPV-DNA screening tests have been suggested as practical diagnostic and prognostic CC markers. 6, Since certain anti-cancer compounds induce cellular stresses that lead to DNA lesion formation, the linkage between cell death, cell invasion, and DNA repair in response to genotoxic agents has become an exciting area in the field of cancer research. 7, Several DNA repair pathways usually repair DNA double-strand breaks (DSBs). If unrepaired, the accumulation of these lesions will trigger cell death mechanisms. 8, Normally, the programmed cell death (PCD) regulates the development and proliferation of tumor cells while the dysfunction of this process leads to cell growth and invasion. 9, Apoptosis, necrotic cell death, and autophagy are the three essential types of PCD. 10, Apoptosis protects neoplastic cells from oxidative stress and hypoxia. 11, This mechanism has two primary pathways, the extrinsic and the intrinsic pathway, and the caspase enzymes are the key regulatory proteins in both pathways. 12, Caspase-3 is a member of the caspase family that activates caspases-6 and -7 necessary for the formation of apoptotic bodies. 13, Previous experiments have shown that low expression of caspase-3 gene may have a facilitative role in the transformation and development of CC. 14, Deficiencies in DNA repair mechanisms can lead to cancer development. 15, A previous study has shown that defects in DNA repair may lead to chromosomal aberrations, leading to malignant transformation of cells. 16, The breast cancer susceptibility gene 1 (BRCA1) is hyperphosphorylated in response to DNA damage and thus activates the repair of DSBs which leads to the initiation of homologous recombination (HR) pathway in response to certain chemicals. 17, The effects of BRCA1 phosphorylation on the HR pathway are not known. BRCA1 is suggested to have a dual regulatory role by maintaining genome integrity and controlling the homology-directed DNA repair. 18, Moreover, to examine the efficiency of the DNA damage repair, the phosphorylated histone H2AX variant (&,gamma -H2AX) has been introduced as a reliable marker. H2AX phosphorylation is required for the recruitment of DNA damage response associated factors at the damaged sites. Hence, determining &,gamma -H2AX levels could determine the efficacy of anti-tumor treatment and to anticipate the sensitivity of different cancer cells to DNA damaging chemicals. 19, Angiogenesis, mediated by several proteins, including vascular endothelial growth factor (VEGF), is the fundamental pathway in CC progression and mortality since tumor cells use new blood and lymphatic vessels for metastatic spread, proliferation, and supply of oxygen. 20,, 21, This endothelial factor is a glycoprotein overexpressed in highly metastatic cells. 22, The VEGF overexpression is associated with suppression of apoptotic cell death while affecting DNA repair mechanisms. 23, Due to many irreversible side effects, the use of chemotherapy or radiotherapy is limited as the primary cancer treatment. Therefore, identifying a new therapeutic approach is necessary while the use of medicinal herbs can be a putative option for this purpose. 24, For example, many natural health products have been suggested as VEGF inhibitors, including Viscum album (European mistletoe), Silybum marianum (milk thistle), and Camellia sinensis (green tea). 25, Moreover, Achillea falcata and Acacia nilotica have shown remarkable anti-proliferative and pro-apoptotic effects on various types of cancer cells. 26, Achillea wilhelmsii, an herbal plant belonging to the family of Asteraceae, contains several components such as flavonoids, alkaloids, and cineol, which have been reported to possess cell death-inducing effects and antioxidant properties. 27, Anti-cancer effects of Achillea wilhelmsii C. Koch hydroalcoholic extract (AWHE) on breast and prostate cancers have been reported in previous studies, but little is known about its putative effects on other types of cancer cells. The present study aimed to evaluate the anti-proliferating and cell death-inducing potential of AWHE on human HeLa cervical cancer cells as well as measuring a very sensitive DNA damage marker. We hypothesized that these signaling pathways could be effective alternatives to conventional chemotherapeutic procedures in CC therapy. Materials and MethodsThe Ethics Committee of Zahedan University of Medical Sciences (Zahedan, Iran) approved the study protocol (code, IR.ZAUMS.REC.1396.375).ChemicalsFetal bovine serum (FBS) was purchased from Gibco (Rockville, MD, USA). 3-(4,5-dimethylhiazol- 2-yl)-2,5-diphenyltetrazolium bromide (MTT) and dimethyl sulfoxide (DMSO) were procured from Sigma (St. Louis, USA). Trypan blue, antibiotic-antimycotic solution, trypsin, phosphate-buffered saline (PBS), and RPMI 1640 culture medium were procured from INOCLON (G. Innovative Biotech Co, Iran). cDNA synthesis kit and SYBR Green PCR Master Mix were purchased from TaKaRa Bio Inc. (Dalian, China) and Ampliqon A/S (Odense, Denmark), respectively.Plant Material and Preparation of the Hydroalcoholic ExtractAerial parts and roots of Achillea wilhelmsii C. Koch were collected during summer 2018 from the southeast regions of Iran. Later, the plant was taxonomically authenticated by the Herbarium of the Department of Biology at the University of Sistan and Balouchestan, Zahedan, Iran (herbarium number, 2345). After drying and grinding, extraction was performed with 70% ethanol solvent (350 mL) using a Soxhlet extractor (50 &,deg C, 5 h). Following filtering of the solution through Whatman 41 filter paper, the hydroalcoholic extract was dried at 45 &,deg C using a centrifugal evaporator (MAXI DRY-LYO, Denmark) to remove the remaining solvent. Then, 100 mg of AWHE was weighed and dissolved in 1 mL of DMSO and kept at -20 &,deg C until further use.Cell Culture and TreatmentsHeLa cervical cancer cells were obtained from the Cell Repository of the Research Institute of Biotechnology, Ferdowsi University of Mashhad (Mashhad, Iran). Cells were cultured in Roswell Park Memorial Institute (RPMI) 1640 culture medium supplemented with 10% FBS and an antibiotic-antimycotic solution containing streptomycin (105 &,micro g/mL), penicillin (100 U/mL), and amphotericin B (2.5 mg/L) incubated under standard cell culture conditions (at 37 &,deg C humidified air containing 95% atmospheric air and 5% CO2). For all measurements, an equal volume of FBS-containing medium (&,lt 1% DMSO as solvent) was used as the control.MTT Cytotoxic AssayThe MTT assay determines the cytotoxicity of an antiproliferative agent at different exposure periods. The cells were seeded in a 96-well plate (4500 cells per well). While reaching 80% confluency, 200 &,micro L of AWHE (with increasing concentrations dissolved in the culture medium, ranging from 0 to 400 &,micro g/mL) was added to each well and incubated for 24, 48, and 72 hours. Then, the cells were again incubated for 4 hours with 0.8 mg/mL of MTT (dissolved in serum-free RPMI 1640 medium). Washing with PBS (1 mL) was followed by the addition of DMSO (1 mL) and gentle shaking for 15 minutes to dissolve the formazan crystals. The absorbance was recorded at 570 nm using a microplate reader (Stat Fax 2100, USA). After 24 to 72 hours of treatment, the half-maximal inhibitory concentration (IC50) values of AWHE were calculated using PRISM 6.0 (GraphPad Software, CA, USA) 28, and concentration-response curves were plotted.Gene Expression AssayPrimer DesignGlyceraldehyde 3-phosphate dehydrogenase (GAPDH), VEGF, BRCA1, and caspase-3 gene sequences were obtained from the National Center for Biotechnology Information database. Using Primer3 software, forward (F) and reverse (R) primer sequences for all four genes were designed (table 1,) to ensure amplification of the transcript variants 1, 2, 4 and 7 of GAPDH, transcript variants 1 to 10 of VEGF, transcript variants 1 to 4 of BRCA1, and transcript variants 1, 2, 3, 5 and 6 of caspase-3. GAPDH was used as a housekeeping gene, which believed to have stable expression and selected as the internal control.GenesSequenceGAPDH (forward)CATGTAGTTGAGGTCAATGAAGGGAPDH (reverse)GAGCCACATCGCTCAGACACVEGF (forward)GAAGGAGGAGGGCAGAATCATCACVEGF (reverse)CACAGGATGGCTTGAAGATGTACTCBRCA1 (forward)ACAGCTGTGTGGTGCTTCTGTGBRCA1 (reverse)CATTGTCCTCTGTCCAGGCATCcaspase-3 (forward)AGAACTGGACTGTGGCATTGAcaspase-3 (reverse)GCTTGTCGGCATACTGTTTCAGAPDH, Glyceraldehyde 3-phosphate dehydrogenase, VEGF, Vascular Endothelial Growth Factor, BRCA1, Breast Cancer Susceptibility gene 1

نویسندگان مقاله Saman Sargazi |
Cellular and Molecular Research Center, Resistant Tuberculosis Institute, Zahedan University of Medical Sciences, Zahedan, Iran

Mahdiyeh Moudi |
Department of Medical Genetics, School of Medicine, Shahid Sadoughi University of Medical Sciences, Yazd, Iran

Omid Kooshkaki |
Department of Immunology, School of Medicine, Birjand University of Medical Sciences, Birjand, Iran

Shekoufeh Mirinejad |
Cellular and Molecular Research Center, Resistant Tuberculosis Institute, Zahedan University of Medical Sciences, Zahedan, Iran

Ramin Saravani |
Cellular and Molecular Research Center, Resistant Tuberculosis Institute, Zahedan University of Medical Sciences, Zahedan, Iran


نشانی اینترنتی https://ijms.sums.ac.ir/article_46737_1f66278b3ae160143ae8608c6b83e4b9.pdf
فایل مقاله فایلی برای مقاله ذخیره نشده است
کد مقاله (doi)
زبان مقاله منتشر شده en
موضوعات مقاله منتشر شده
نوع مقاله منتشر شده
برگشت به: صفحه اول پایگاه   |   نسخه مرتبط   |   نشریه مرتبط   |   فهرست نشریات