این سایت در حال حاضر پشتیبانی نمی شود و امکان دارد داده های نشریات بروز نباشند
Iranian Journal of Medical Sciences، جلد ۵۰، شماره ۱۲، صفحات ۸۳۲-۸۴۲

عنوان فارسی
چکیده فارسی مقاله
کلیدواژه‌های فارسی مقاله

عنوان انگلیسی Oxidative Stress Influences Exosome Biogenesis by Inducing Cellular Senescence in Uterine Adenocarcinoma Ishikawa Cells
چکیده انگلیسی مقاله Background: The progression of life and cellular senescence can alter the physiological activity of every cell type. Here, the possible effect of oxidative stress on exosome (Exo) biogenesis was studied in endometrial adenocarcinoma Ishikawa cells. 
Methods: This in vitro study was conducted from 2022 to 2023 at the Stem Cell Research Center affiliated with Tabriz University of Medical Sciences. Cells were treated with 20 μM hydrogen peroxide (H2O2) for 4 days, and physicochemical properties of Exos were analyzed using dynamic light scattering (DLS), scanning electron microscope (SEM), and western blotting. The expression of genes such as ALIX, CD63, TSG101, Rab27a, and Rab27b, along with aging factor senescence-associated 𝛽-galactosidase (SA-β-gal), was studied using real-time PCR analysis. The fatty acid profile was determined in isolated Exos using gas chromatography. We also measured the exosomal content of superoxide dismutase (SOD), glutathione peroxidase (GPx), and malondialdehyde (MDA).  
Results: The expression of SA-β-gal confirmed the successful induction of aging in Ishikawa cells after 4 days (P=0.0286). DLS analysis indicated a slight increase and decrease in mean Exo size and zeta potential, respectively, in H2O2-treated Exos compared to the control group. Proteomic analysis revealed the lack of changes in exosomal levels of CD63 and CD81 tetraspanins in both groups (P=0.001). Real-time PCR analysis indicated the upregulation of ALIX and TSG101, while the expression of CD63 and Rab27b was reduced in H2O2-treated cells compared to the control group (P=0.0015 and P=0.0129). No statistically significant changes were found in exosomal levels of SOD, GPx, and MDA before and after treatment with the H2O2 (P=0.857, P=0.421, and P=0.3739). Data indicated an increase in exosomal polyunsaturated fatty acids and monounsaturated fatty acids in H2O2-treated cells compared to the control cells.
Conclusion: Oxidative stress can influence Exo biogenesis and paracrine activity in endometrial tumor cells via the induction of cellular senescence.
کلیدواژه‌های انگلیسی مقاله Uterine neoplasms, Cellular senescence, Extracellular vesicles, Biogenesis, Paracrine communication, What&,rsquo s Known Exosomes are involved in intercell communication via a paracrine manner. Several pathological conditions can influence exosome biogenesis in host cells. What&,rsquo s New The effect of oxidative stress was investigated in exosome biogenesis inside cancer cells. Oxidative stress increases the expression of exosome biogenesis genes. The levels of polyunsaturated fatty acids were increased in exosome structure. IntroductionNumerous data have revealed the existence of various communication mechanisms between the homogenous and heterogeneous cells within the unicellular and multicellular systems. 1, Cells can intercommunicate in a paracrine manner via the production and release of extracellular vesicles (EVs) harboring soluble factors and signaling molecules. Exosomes (Exos), belonging to the EV family, have an average diameter of 30-150 nm with an endosomal system origin. 2, Inside the cytosol, early endosomes can mature into late endosomes and then multivesicular bodies (MVBs), where numerous intraluminal vesicles (ILVs) are generated via the invagination of the vesicle membrane. In the latter phases, the fusion of MVBs with the cell membrane leads to the release of ILVs into the extracellular matrix (ECM), which are also called Exos. 3, Several scientific studies have indicated the critical role of Exos in intercellular communication under physiological and pathological conditions. 4, Almost all cell types use an endosomal system for mutual communication and regulation of dynamic growth, immune responses, and cell signaling for differentiation and regeneration. 5, Thus, Exos are abundant in biofluids such as serum, saliva, urine, blood, amniotic fluid, cerebrospinal fluid, and others. 6, , 7, It is postulated that the regenerative properties and modulatory effects of Exos can be changed concerning physiological and pathological conditions. In addition to morphological features, the type and content of luminal cargo can also be altered. 8, , 9, For example, the advent of cellular senescence can affect the molecular signature of Exos. However, it has been shown that Exos are eligible bioshuttles to carry age-related pathologies such as Alzheimer&,rsquo s disease in an autocrine, paracrine, and endocrine mechanism. 10, , 11, There is evidence that the aging phenomenon can increase the number of Exos (~30-50 times) in the circulation and tissues. Several studies on various types of cells, such as endothelial cells, fibroblasts, and epithelial cells, confirmed an increase in Exo secretion with the progression of aging. The mechanism supporting increased EV production in aging has not been fully studied. 12, , 13, Molecular investigations have confirmed specific factors associated with inflammation and oncogenesis inside the aged cell, Exos senescence-associated secretory phenotype (SASP). 3, The exposure of human prostate cancer cells to irradiation and the progression of aging changes led to the bulk production of EVs. 14, Whether age-related Exos can increase/reduce the dynamic growth of tumor mass is a subject of debate. Besides, it remains to address how the aging process can affect Exo biogenesis in cancer cells. Commensurate with these descriptions, this study aims to address the possible impact of cellular senescence in the endometrial adenocarcinoma cell line, Ishikawa cells, paracrine activity, and Exo biogenesis. Data from the current study can help find effective ways to control tumor development within the female reproductive system.Materials and MethodsThe study&,rsquo s data collection and analysis took place at the Stem Cell Research Center, an affiliate of Tabriz University of Medical Sciences, between 2022 and 2023. All steps of this study were approved by the Local Ethics Committee of Tabriz University of Medical Sciences (IR.TBZMED.VCR.REC.1400.043). Cell Culture Protocol The Ishikawa cells were obtained from the Stem Cell Research Center, an affiliated research center of Tabriz University of Medical Sciences. Cells were cultured in Dulbecco&,rsquo s Modified Eagle&,rsquo s Medium-High Glucose (DMEM-HG) (Gibco, USA) with 10% fetal bovine serum (FBS) (Gibco, USA) and 1% Penicillin-streptomycin (Pen-Strep) (Gibco, USA) solution. Cells were allowed to reach 70-80% before subculture. Using 0.25% trypsin-ethylenediaminetetraacetic acid (trypsin-EDTA) solution (Gibco, USA), the cells were cultured and transferred to new culture plates. Experimental Groups Cells at passages between 3-6 were allocated into the Control and H2O2-treated groups. To reduce the confounding effects of serum Exos, Ishikawa cells were incubated with a culture medium containing 1% Exo-free FBS (Lot No, 1,639,959 Gibco, USA) and 1% Pen-Strep solution. To induce aging changes, cells were exposed to 20 &,mu M of hydrogen peroxide (H2O2) (Merck, Germany) for 4 days and subjected to several analyses. Morphological Assessment The possible effect of H2O2 on Ishikawa cells was monitored after 4 days in terms of cell morphology using a bright-field microscope (Labomed, USA). Exo Isolation and Characterization For this purpose, supernatants were collected from both groups and centrifuged at 300 g for 10 min to remove the cells. Then, dead cells or cellular residues were excluded by subsequent centrifugation at 2000 g for 10 min and 10,000 g for 30 min, respectively. Eventually, Exos were collected by ultracentrifugation (Beckman Coulter Inc. OptimaTM TLX-120 ultracentrifuge, USA) at 100,000 g for 1 hour. Exo pellets were dissolved in phosphate-buffered saline (PBS) and kept at -80 &,deg C until use. Dynamic Light Scattering (DLS) Exos collected from both groups were monitored in terms of hydrodynamic size and zeta potential value using a DLS analysis (Malvern Nano ZS, Herrenberg, Germany). Scanning Electron Microscope (SEM) Using SEM images, we also studied the morphologies of isolated Exos from H2O2-treated cells. For this purpose, the samples were fixed with 2.5% glutaraldehyde solution (Sigma&,ndash Aldrich, Germany), gold-sputtered, and imaged using the SEM system (Model, MIRA3 FEG-SEM (Field Emission Gun Scanning Electron Microscopy) TESCAN). An average Exo size was measured using ImageJ (Ver. 1.46 NIH) software (National Institutes of Health and the Laboratory for Optical and Computational Instrumentation (LOCI, University of Wisconsin). Immunophenotyping of Exos We performed Western blotting to measure protein levels of CD63 and CD81 surface markers in collected Exos. Initially, Exos were lysed with a radioimmunoprecipitation assay buffer (RIPA) (150 mM NaCl, 0.1 % SDS, 50 mM Tris-HCl, 2 mM EDTA, and 1% NP40, Bio-Rad), and protein concentration was measured using the Bradford method. After separating the proteins by 10% Sodium dodecyl sulfate&,ndash polyacrylamide gel electrophoresis (SDS-PAGE), the isolated protein bands were transferred onto the Polyvinylidene difluoride (PVDF) membrane. Membranes were blocked in 2% skim milk for 60 min and incubated with mouse anti-CD63 antibody (dilution, 1,200 sc-5275 Santa Cruz Biotechnology, USA) and mouse anti-CD81 antibody (dilution, 1,100 sc-166029 Santa Cruz Biotechnology, USA) for 16-18 hours. After three washes with Tris-Buffered Saline-Tween 20 (TBST) (Sigma-Aldrich) buffer, membranes were incubated in mouse anti-rabbit Horseradish peroxidase-conjugated (HRP-conjugated) secondary antibody (sc-2357 Santa Cruz Biotechnology) for 1 hour at room temperature, followed by three TBST washes (each for 15 min). The membranes were exposed to enhanced chemiluminescence (ECL) solution, and immunoblots were visualized using X-ray films. Gas-Liquid Chromatography (GC) The possible effect of H2O2 on lipid content was monitored using GC. The fatty acid components of isolated Exos were extracted using the gas-liquid chromatography method. Lipid conversion to methyl ester was done with a direct transesterification method using methanol-hexane solution [2 mL 4,1 (v/v)] and with the addition of acetyl chloride (200 &,micro L). Samples were methanolyzed using a temperature of 100 &,deg C for 1 hour. Then, by adding K2CO3 (6% w/v), the hexane phase containing the lipid was separated. The methyl esters were detected by GC relative to an internal standard. Raw data were analyzed using PeakSimple, version 3.59 (SRI Inc., USA). Tridecanoic acid (13,0) was used as an internal control. Quantitative Real-time PCR Assay (qRT-PCR) The expression of genes involved in the biogenesis of Exos was analyzed by real-time PCR. Total RNA was extracted using the TRIzol method (Super TRIzol Reagent Maxwell, Promega Co., USA). The concentration and integrity were evaluated by using a PicoDrop spectrophotometer (PICOPET01 UK). For cDNA synthesis, we used the cDNA Synthesis Kit (Cat No., YT4500 Yekta Tajhiz, Iran), and the procedure was done according to the manufacturer&,rsquo s protocol. The expression of exosome biogenesis-specific genes such as ALIX, CD63, TSG101, Rab27a, Rab27b, and SA-&,beta -gal was evaluated (table 1,). Each reaction included a total volume of 14 &,micro L containing 1 &,micro L of each of the forward and reverse primers (diluted 1,10), 4 &,micro L H2O, 7 &,micro L SYBR green DNA PCR Master Mix (Cat No., YT2551 Ampliqon, Denmark), and 1 &,micro L sample cDNA. All samples were normalized against GAPDH (as an internal control gene) using the comparative CT method (2-&,Delta &,Delta CT). Primer sets were ordered based on the previously designed and validated publication. 8, GenesNCBI accession numberSequences (5&,rsquo 3&,rsquo )Annealing temperature (&,#9702 C)Rab27aNM_004580.5FAGAGGAGGAAGCCATAGCAC59RCATGACCATTTGATCGCACCACRab27bNM_001375327.1FGGAACTGGCTGACAAATATGG59RCAGTATCAGGGATTTGTGTCTTAlixNM_001162429.3FCTGGAAGGATGCTTTCGATAAAGG63RAGGCTGCACAATTGAACAACACCD63NM_001257389.2FTCCTGAGTCAGACCATAATCC63RGATGGCAAACGTGATCATAAGGLB1NM_001135602.3FGTTCGCATCCTCCCTCTGTTG60RTTTCAAACATCCTCTGGGTGGCGAPDHNM_001256799.3FCAAGTTCAACGGCACAGTCAAG59RATACTCAGCACCAGCATCACCF, Forward R, Reverse NCBI, National Center for Biotechnology Information

نویسندگان مقاله Fatemeh Sokouti Nasimi |
Stem Cell Research Center, Tabriz University of Medical Sciences, Tabriz, Iran

Behrad Alimohammadzadeh |
Stem Cell Research Center, Tabriz University of Medical Sciences, Tabriz, Iran

Amir Mehdizadeh |
Hematology and Oncology Research Center, Tabriz University of Medical Sciences, Tabriz, Iran

Dhafer A.F. AL-Koofee |
Department of Clinical Laboratory Science, Faculty of Pharmacy, University of Kufa, Najaf, Kufa 54003, Iraq

Amin Tamadon |
Department of Natural Sciences, West-Kazakhstan Marat Ospanov Medical University, Aktobe, Kazakhstan

Mahdi Mahdipour |
Stem Cell Research Center, Tabriz University of Medical Sciences, Tabriz, Iran

Reza Rahbarghazi |
Stem Cell Research Center, Tabriz University of Medical Sciences, Tabriz, Iran


نشانی اینترنتی https://ijms.sums.ac.ir/article_51356_2e5787aca5efd4203f8da8c4ad0155f8.pdf
فایل مقاله فایلی برای مقاله ذخیره نشده است
کد مقاله (doi)
زبان مقاله منتشر شده en
موضوعات مقاله منتشر شده
نوع مقاله منتشر شده
برگشت به: صفحه اول پایگاه   |   نسخه مرتبط   |   نشریه مرتبط   |   فهرست نشریات