| کلیدواژههای انگلیسی مقاله |
Fibrillin-1, Fibrillin-2, Esophageal neoplasms, Esophageal squamous cell carcinoma, What&,rsquo s Known In previous studies, changes in fibrillin-1 or fibrillin-2 have been examined separately in cancers such as pancreatic ductal adenocarcinoma and lung cancer. What&,rsquo s New For the first time, we compared changes in fibrillin-1 and fibrillin-2 expression in esophageal cancer tissue with normal tissue. We also reported the expression of fibrillins in the Genotype-Tissue Expression database and the GENT2 dataset tool. Our results showed that changes in the expression of fibrillin-1 and fibrillin-2 lead to changes in the extracellular matrix of esophageal cancer tissue compared to normal tissue. IntroductionEsophageal cancer is one of the most common cancers of the digestive tract and one of the most common aggressive tumors globally. 1, This cancer is the eighth most common worldwide and the sixth leading cause of cancer-related death. It has a poor prognosis, with a five-year survival rate of approximately 15-20%. 1, , 2, Due to the lack of early clinical manifestations, esophageal cancer is typically diagnosed at advanced stages. 3, , 4, Esophageal cancer divides into two subtypes in terms of histology, esophageal squamous cell carcinoma (ESCC), which originates from the stratified squamous epithelial lining of the esophagus (approximately 90 %), and esophageal adenocarcinoma (EAC), which involves columnar epithelial cells that replace the squamous epithelium (about 10 %). 2, , 4, , 5, Of these two types of esophageal cancers, ESCC is the dominant tissue subtype and is also known as one of the most aggressive cancers worldwide. 4, , 5, Studies have shown that tumorigenesis is generally associated with changes in the composition of the extracellular matrix (ECM). Human fibrillins (FBNs) are large cysteine-rich glycoproteins and the main component of fibrous structures in the ECM that multimerize to form microfibrils. Microfibrils in the ECM have mechanical functions and are effective in cell adhesion. These microfibrils are macromolecular complexes that are components of elastic fibers (a vital part of the ECM) and even components of non-elastic tissues. 6, - 9, In elastic fiber assembly, microfibrils are the first structures formed, and FBNs play the role of a scaffold for tropoelastin deposition. 9, Within the microfibril structure, the FBNs interact with different components of microfibrils, for example, with microfibril-associated glycoprotein (MAGP)-1 and 2, fibulins, and the latent transforming growth factor-&,beta -binding proteins (LTBPs) 1, 2, and 4. 9, - 11, There are three FBN isoforms in humans, each encoded by a different gene, fibrillin-1 (FBN1), fibrillin-2 (FBN2), and fibrillin-3 (FBN3). 12, All three glycoproteins are 320 to 350 kDa, 10, , 12, and at the amino acid level, these three isoforms are homologous 6, but show slight differences for example, FBN1 has a proline-rich part, FBN2 has a glycine-rich part, and FBN3 has a proline and glycine-rich part. 9, The members of this superfamily also undergo post-translational modifications. FBN1 has 14 glycosylation sites, FBN2 has 12, and FBN3 has 10. 9, The human FBN1 gene is located in 15q15&,ndash 21.3 and is one of the main components of 10&,ndash 12 nm ECM microfibrils with structural roles and is involved in creating the tensile strength of the ECM. 5, , 10, , 12, FBN1 plays a role in regulating the tissue microenvironment. 13, FBN1 is also involved in endothelial cell adhesion, and its expression is high in most cells of mesenchymal origin. 9, Mutations in the FBN1 coding gene lead to a rare autosomal dominant and hereditary disease called Marfan syndrome, in which the skin, nervous system, heart and blood vessels, eyes, and skeletal muscles are affected. Mutations in this gene also affect growth factors such as Transforming Growth Factor Beta (TGF-&,beta ) and increase the expression and activation of TGF-&,beta . 14, , 15, Altered FBN1 expression levels have been reported in various cancers, including thyroid, colorectal, ovarian, pancreatic ductal adenocarcinoma (PDAC), and esophageal cancers. 5, , 16, , 17, The human FBN2 gene is located in 5q23 31 and is expressed in the early stages of development (during embryogenesis). 5, , 12, Its expression is more limited in mesenchymal cells after birth. 5, However, FBN2 also has roles after birth it forms the central core of microfibrils, which are covered by an outer layer of FBN1. 5, , 7, FBN2 plays a vital role in the formation and accumulation of elastic fibers and fibronectin around tracheal smooth muscle cells. 18, Congenital contractile arachnodactyly is a rare autosomal dominant hereditary connective tissue disease resulting from a mutation in the FBN2 gene. 19, Alterations in FBN2 expression levels have been observed in several cancers for instance, its increased expression has been reported in lung and colorectal cancers. 5, , 20, The expression of FBN3 decreases after birth, and unlike FBN1 and FBN2, FBN3 has a high expression in the brain, as observed in a human fetal brain library. 19, , 21, Considering the structural role of FBNs in microfibrils and their presence in elastic and non-elastic tissues, these genes have been investigated in several cancers. For example, the role of FBN1 and FBN2 has been studied separately in different cancers, including significant expression of FBN1 in thyroid cancer. 5, The association between FBN1 and the infiltration of immune cells in PDAC, 17, increased expression of FBN2 in lung cancer. 20, The association between FBN1 and metastasis in ovarian cancer, 16, and changes in the expression level of FBNs in colorectal cancer. 22, - 24, Due to conflicting findings regarding FBNs expression in various cancers and the absence of prior reports on their expression in ESCC, this study aims to evaluate FBN1 and FBN2 expression in ESCC.Materials and Methods Sample Collection In this cross-sectional study, we collected tumor tissue samples and tumor margins from 22 patients with ESCC who had visited hospitals in Golestan province, Iran, from 2020 to 2022. The sample size was estimated according to a pilot study of 10 samples with a mean fold change&,plusmn SD of 0.5767&,plusmn 0.7718 for FBN1 and 8.35&,plusmn 7.1338 for FBN2 compared to a constant value of 1 for the normal group. Using the GPower 3.1 software (Edgar Erdfelder, Franz Faul, Albert-Georg Lang, and Axel Buchner Germany), with a power of 0.8 and &,alpha error probability equal to 0.05, the maximum sample size was calculated at 22. Physicians diagnosed the necessity for surgery for all patients. Inclusion criteria consisted of newly diagnosed ESCC cases with no prior chemotherapy or radiotherapy treatment. Oral and written informed consent were obtained from all participants. After surgery, we collected tumor samples and paired tumor-adjacent normal tissue biopsies (approximately 5 cm from the tumor site) and checked them regarding histopathology. The collected specimens were transferred to Gorgan University of Medical Sciences with dry ice and were kept at -80 &,deg C. The ethics code of this research is IR.GOUMS.REC.1400.438, approved by the ethics committee of Golestan University of Medical Sciences. Gene Expression Analysis We extracted total RNA from each sample using TRIzol Reagent (Invitrogen, CA), dissolved it in DEPC-treated water, and then treated it with DNase I (Thermo Fisher Scientific, Inc., United States). The RNA concentration and purity were determined using the A260/A280 ratio in NanoDrop technologies. After that, cDNA synthesis from the RNA was performed according to the protocol of the synthesis kit of Yekta Tajhiz Company (Iran) using reverse transcriptase (M-MULV) from RNA. The primer sequences used for FBN1, FBN2, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) genes are presented in table 1,. We used GAPDH for all samples as an internal control an gene expression normalization with a 2-&,Delta &,Delta ct formula. GenesForwardReverseFBN1TTTAGCGTCCTACACGAGCCCCATCCAGGGCAACAGTAAGCFBN2CCTCCCGCCCTCTCTCTTGACAAAAGTCGCCCCCAGAAGGAPDHGGAGCGAGATCCCTCCAAAATGGCTGTTGTCATACTTCTCATGGFBN1, Fibrillin-1 FBN2, Fibrillin-2 GAPDH, Glyceraldehyde-3-phosphate dehydrogenase |